Non-island cell tumor hypoglycemia (NICTH) is a rare paraneoplastic syndrome that secrete insulin molecule is not complete processing heavy high growth factor 2 (big-IGF2), which results in stimulation of insulin receptor and then inducing hypoglycemia. Gastrointestinal stromal tumor (GIST) is a common intestinal mesenchymal neoplasms of the gastrointestinal tract. Sites often the majority of GIST is the stomach; NICTH caused by stomach GISTs IGF2-producing is rare.An man 84 years was admitted to the hospital because of disturbance of consciousness (JCS II-10) in the morning. At the time of admission, his serum glucose was 44 mg / dL; consciousness was restored with 20 ml of 50% glucose. To avoid hypoglycemia, continuous intravenous infusion of glucose and dietary interventions are required.

At the time of hypoglycemia, insulin and C-peptide suppressed. In addition, IGF1 levels were below the normal range. Abdominal computed tomography revealed that he had a large lobulated mass (116 × 70 × 72 mm) around the corpus of the stomach.

pathological analysis of biopsy specimens messy identified spindle cells and positive for c-kit as well as a strong positive for the DOG-1. Further analysis revealed high levels of Ki-67 (Mib-1 Index: 15.5%) and mitotic index (7 / 50HPF); GIST tumors are diagnosed as high risk, and complete surgical resection performed.

Hypoglycemia be resolved after tumor resection. Resected tumor specimens positive for IGF2 staining, and large-IGF2 (11-18 kDa) was detected in the preoperative serum and tumor samples; patients diagnosed with NICTH for their IGF2-producing tumor.NICTH rare in GIST of the stomach; However, large GIST can produce large-IGF2 and subsequently cause severe hypoglycemia, requiring quick evaluation and complete tumor resection.

A case of <em>insulin</em>-<em>like</em> <em>growth</em> <em>factor</em> <em>2</em>-producing gastrointestinal stromal tumor with severe hypoglycemia.
A case of insulinlike growth factor 2-producing gastrointestinal stromal tumor with severe hypoglycemia.

Downregulation of miR-637 promotes vascular smooth muscle cell proliferation and migration through regulation insulin – like growth factor – < em> 2 .

Dysregulation of proliferation and migration of vascular smooth muscle cells (VSMC) is an important cause of atherosclerosis. MiR-637 exerts antiproliferative effects on some human cells. impact on atherosclerosis remains largely unexplored.Real-time PCR was used to determine the expression of miR-637 in samples from patients and animal models of atherosclerosis. expression in VSMC dysfunction models (induced by ox-LDL) were measured. Proliferation and migration of VSMC were each tested by using CCK-8 and the test Transwell, and apoptosis was measured using flow cytometry.

The Targetscan database used to predict the miR-637 target genes. The interaction between miR-637 and a potential target genes validated by real-time PCR, Western blotting and luciferase reporter assay.MiR-637 significantly decreased the expression in atherosclerosis patients and animal model samples. It also decreased in a dose-and time-dependent in animal models of atherosclerosis ox-LDL-induced.

IGF2 Polyclonal Antibody

ABP58900-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human IGF2 protein
  • Applications tips:
Description: A polyclonal antibody for detection of IGF2 from Human, Mouse, Rat. This IGF2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human IGF2 protein

IGF2 Polyclonal Antibody

ES10707-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IGF2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

IGF2 Polyclonal Antibody

ES10707-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IGF2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

IGF2-BP2 Polyclonal Antibody

ABP53530-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human IGF2-BP2 at AA rangle: 110-190
  • Applications tips:
Description: A polyclonal antibody for detection of IGF2-BP2 from Human. This IGF2-BP2 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human IGF2-BP2 at AA rangle: 110-190

IGF2-BP2 Polyclonal Antibody

ABP53530-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human IGF2-BP2 at AA rangle: 110-190
  • Applications tips:
Description: A polyclonal antibody for detection of IGF2-BP2 from Human. This IGF2-BP2 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human IGF2-BP2 at AA rangle: 110-190

IGF2-BP2 Polyclonal Antibody

ABP53530-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human IGF2-BP2 at AA rangle: 110-190
  • Applications tips:
Description: A polyclonal antibody for detection of IGF2-BP2 from Human. This IGF2-BP2 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human IGF2-BP2 at AA rangle: 110-190

IGF2-BP2 Polyclonal Antibody

ES4529-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IGF2-BP2 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

IGF2-BP2 Polyclonal Antibody

ES4529-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IGF2-BP2 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

Polyclonal IGF2 Antibody (Center R54)

APR03540G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human IGF2 (Center R54). This antibody is tested and proven to work in the following applications:

Bovine Insulin Like Growth Factor 2 (IGF2) ELISA Kit

DLR-IGF2-b-48T 48T
EUR 493
  • Should the Bovine Insulin Like Growth Factor 2 (IGF2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Bovine Insulin Like Growth Factor 2 (IGF2) in samples from serum, plasma or other biological fluids.

Bovine Insulin Like Growth Factor 2 (IGF2) ELISA Kit

DLR-IGF2-b-96T 96T
EUR 641
  • Should the Bovine Insulin Like Growth Factor 2 (IGF2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Bovine Insulin Like Growth Factor 2 (IGF2) in samples from serum, plasma or other biological fluids.

Human Insulin Like Growth Factor 2 (IGF2) ELISA Kit

DLR-IGF2-Hu-48T 48T
EUR 425
  • Should the Human Insulin Like Growth Factor 2 (IGF2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Insulin Like Growth Factor 2 (IGF2) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.

Human Insulin Like Growth Factor 2 (IGF2) ELISA Kit

DLR-IGF2-Hu-96T 96T
EUR 548
  • Should the Human Insulin Like Growth Factor 2 (IGF2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Insulin Like Growth Factor 2 (IGF2) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.

Mouse Insulin Like Growth Factor 2 (IGF2) ELISA Kit

DLR-IGF2-Mu-48T 48T
EUR 435
  • Should the Mouse Insulin Like Growth Factor 2 (IGF2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Insulin Like Growth Factor 2 (IGF2) in samples from serum, plasma or other biological fluids.

Mouse Insulin Like Growth Factor 2 (IGF2) ELISA Kit

DLR-IGF2-Mu-96T 96T
EUR 561
  • Should the Mouse Insulin Like Growth Factor 2 (IGF2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Insulin Like Growth Factor 2 (IGF2) in samples from serum, plasma or other biological fluids.

Porcine Insulin Like Growth Factor 2 (IGF2) ELISA Kit

DLR-IGF2-p-48T 48T
EUR 493
  • Should the Porcine Insulin Like Growth Factor 2 (IGF2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Porcine Insulin Like Growth Factor 2 (IGF2) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Porcine Insulin Like Growth Factor 2 (IGF2) ELISA Kit

DLR-IGF2-p-96T 96T
EUR 641
  • Should the Porcine Insulin Like Growth Factor 2 (IGF2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Porcine Insulin Like Growth Factor 2 (IGF2) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat Insulin Like Growth Factor 2 (IGF2) ELISA Kit

DLR-IGF2-Ra-48T 48T
EUR 454
  • Should the Rat Insulin Like Growth Factor 2 (IGF2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Insulin Like Growth Factor 2 (IGF2) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat Insulin Like Growth Factor 2 (IGF2) ELISA Kit

DLR-IGF2-Ra-96T 96T
EUR 587
  • Should the Rat Insulin Like Growth Factor 2 (IGF2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Insulin Like Growth Factor 2 (IGF2) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rabbit Insulin Like Growth Factor 2 (IGF2) ELISA Kit

DLR-IGF2-Rb-48T 48T
EUR 454
  • Should the Rabbit Insulin Like Growth Factor 2 (IGF2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rabbit Insulin Like Growth Factor 2 (IGF2) in samples from serum, plasma or other biological fluids.

Rabbit Insulin Like Growth Factor 2 (IGF2) ELISA Kit

DLR-IGF2-Rb-96T 96T
EUR 587
  • Should the Rabbit Insulin Like Growth Factor 2 (IGF2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rabbit Insulin Like Growth Factor 2 (IGF2) in samples from serum, plasma or other biological fluids.

Bovine Insulin Like Growth Factor 2 (IGF2) ELISA Kit

RDR-IGF2-b-48Tests 48 Tests
EUR 516

Bovine Insulin Like Growth Factor 2 (IGF2) ELISA Kit

RDR-IGF2-b-96Tests 96 Tests
EUR 716

Human Insulin Like Growth Factor 2 (IGF2) ELISA Kit

RDR-IGF2-Hu-48Tests 48 Tests
EUR 436

Human Insulin Like Growth Factor 2 (IGF2) ELISA Kit

RDR-IGF2-Hu-96Tests 96 Tests
EUR 601

Mouse Insulin Like Growth Factor 2 (IGF2) ELISA Kit

RDR-IGF2-Mu-48Tests 48 Tests
EUR 447

Mouse Insulin Like Growth Factor 2 (IGF2) ELISA Kit

RDR-IGF2-Mu-96Tests 96 Tests
EUR 618

Porcine Insulin Like Growth Factor 2 (IGF2) ELISA Kit

RDR-IGF2-p-48Tests 48 Tests
EUR 516

Porcine Insulin Like Growth Factor 2 (IGF2) ELISA Kit

RDR-IGF2-p-96Tests 96 Tests
EUR 716

Rat Insulin Like Growth Factor 2 (IGF2) ELISA Kit

RDR-IGF2-Ra-48Tests 48 Tests
EUR 470

Rat Insulin Like Growth Factor 2 (IGF2) ELISA Kit

RDR-IGF2-Ra-96Tests 96 Tests
EUR 651

Rabbit Insulin Like Growth Factor 2 (IGF2) ELISA Kit

RDR-IGF2-Rb-48Tests 48 Tests
EUR 470

Rabbit Insulin Like Growth Factor 2 (IGF2) ELISA Kit

RDR-IGF2-Rb-96Tests 96 Tests
EUR 651

Bovine Insulin Like Growth Factor 2 (IGF2) ELISA Kit

RD-IGF2-b-48Tests 48 Tests
EUR 494

Bovine Insulin Like Growth Factor 2 (IGF2) ELISA Kit

RD-IGF2-b-96Tests 96 Tests
EUR 684

Human Insulin Like Growth Factor 2 (IGF2) ELISA Kit

RD-IGF2-Hu-48Tests 48 Tests
EUR 418

Human Insulin Like Growth Factor 2 (IGF2) ELISA Kit

RD-IGF2-Hu-96Tests 96 Tests
EUR 575

Mouse Insulin Like Growth Factor 2 (IGF2) ELISA Kit

RD-IGF2-Mu-48Tests 48 Tests
EUR 429

Mouse Insulin Like Growth Factor 2 (IGF2) ELISA Kit

RD-IGF2-Mu-96Tests 96 Tests
EUR 591

Porcine Insulin Like Growth Factor 2 (IGF2) ELISA Kit

RD-IGF2-p-48Tests 48 Tests
EUR 494

Porcine Insulin Like Growth Factor 2 (IGF2) ELISA Kit

RD-IGF2-p-96Tests 96 Tests
EUR 684

Rat Insulin Like Growth Factor 2 (IGF2) ELISA Kit

RD-IGF2-Ra-48Tests 48 Tests
EUR 450

Rat Insulin Like Growth Factor 2 (IGF2) ELISA Kit

RD-IGF2-Ra-96Tests 96 Tests
EUR 622

Rabbit Insulin Like Growth Factor 2 (IGF2) ELISA Kit

RD-IGF2-Rb-48Tests 48 Tests
EUR 450

Rabbit Insulin Like Growth Factor 2 (IGF2) ELISA Kit

RD-IGF2-Rb-96Tests 96 Tests
EUR 622

IGF2 antibody

70R-12270 100 ug
EUR 460
Description: Rabbit polyclonal IGF2 antibody

IGF2 antibody

70-IR16 50 ug
EUR 327
Description: Affinity purified Rabbit polyclonal IGF2 antibody

IGF2 Antibody

32592-100ul 100ul
EUR 252

IGF2 antibody

10R-I135a 100 ug
EUR 555
Description: Mouse monoclonal IGF2 antibody

IGF2 Antibody

49302-100ul 100ul
EUR 333

IGF2 Antibody

49302-50ul 50ul
EUR 239

IGF2 Antibody

DF6810 200ul
EUR 304
Description: IGF2 Antibody detects endogenous levels of total IGF2.

IGF2 Antibody

DF2516 200ul
EUR 304
Description: IGF2 antibody detects endogenous levels of total IGF2.

IGF2 Antibody

BF0039 200ul
EUR 376
Description: IGF2 antibody detects endogenous levels of total IGF2.

IGF2 Antibody

EUR 335
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against IGF2. Recognizes IGF2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:2000

IGF2 Antibody

CSB-PA011088KA01HU-100ul 100ul
EUR 389
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against IGF2. Recognizes IGF2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:2000

IGF2 Antibody

ABD2516 100 ug
EUR 438

IGF2 Antibody

ABD6810 100 ug
EUR 438


E21-F61 10ug
EUR 343


LF-PR027 50 ug
EUR 177
Description: IGF2 protein

IGF2 Conjugated Antibody

C49302 100ul
EUR 397

Anti-IGF2 antibody

STJ24139 100 µl
EUR 277
Description: This gene encodes a member of the insulin family of polypeptide growth factors, which are involved in development and growth. It is an imprinted gene, expressed only from the paternal allele, and epigenetic changes at this locus are associated with Wilms tumour, Beckwith-Wiedemann syndrome, rhabdomyosarcoma, and Silver-Russell syndrome. A read-through INS-IGF2 gene exists, whose 5' region overlaps the INS gene and the 3' region overlaps this gene. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-IGF2 antibody

STJ115940 100 µl
EUR 277
Description: This gene encodes a member of the insulin family of polypeptide growth factors, which are involved in development and growth. It is an imprinted gene, expressed only from the paternal allele, and epigenetic changes at this locus are associated with Wilms tumour, Beckwith-Wiedemann syndrome, rhabdomyosarcoma, and Silver-Russell syndrome. A read-through INS-IGF2 gene exists, whose 5' region overlaps the INS gene and the 3' region overlaps this gene. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-IGF2 antibody

STJ191865 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to IGF2

Polyclonal IGF2 (aa81-93) Antibody (internal region)

APG00772G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human IGF2 (aa81-93) (internal region). This antibody is tested and proven to work in the following applications:

IGF2 protein

30R-1836 50 ug
EUR 397
Description: Purified recombinant Human IGF2 protein

IGF2 protein

30-AI89 50 ug
EUR 298
Description: Purified recombinant Human IGF2 protein


YF-PA12620 50 ug
EUR 363
Description: Mouse polyclonal to IGF2


YF-PA12621 100 ug
EUR 403
Description: Rabbit polyclonal to IGF2

Anti-IGF2-BP2 antibody

STJ93649 200 µl
EUR 197
Description: Rabbit polyclonal to IGF2-BP2.

Insulin Like Growth Factor 2 (IGF2) Polyclonal Antibody (Bovine)

  • EUR 259.00
  • EUR 2694.00
  • EUR 667.00
  • EUR 326.00
  • EUR 218.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Bovine Insulin Like Growth Factor 2 (IGF2)

Insulin Like Growth Factor 2 (IGF2) Polyclonal Antibody (Human)

  • EUR 232.00
  • EUR 2285.00
  • EUR 574.00
  • EUR 289.00
  • EUR 208.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IGF2 (Ala25~Glu91)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Insulin Like Growth Factor 2 (IGF2)

Insulin Like Growth Factor 2 (IGF2) Polyclonal Antibody (Mouse)

  • EUR 236.00
  • EUR 2338.00
  • EUR 586.00
  • EUR 294.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IGF2 (Ala25~Glu91)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Insulin Like Growth Factor 2 (IGF2)

Insulin Like Growth Factor 2 (IGF2) Polyclonal Antibody (Rat)

  • EUR 243.00
  • EUR 2457.00
  • EUR 613.00
  • EUR 305.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IGF2 (Ala25~Glu91)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Insulin Like Growth Factor 2 (IGF2)

Monoclonal IGF2 Antibody, Clone: 8H1

APR07954G 0.1ml
EUR 528
Description: A Monoclonal antibody against Human IGF2. The antibodies are raised in Mouse and are from clone 8H1. This antibody is applicable in WB and IHC, FC, ICC, E

Monoclonal IGF2 Antibody, Clone: 519CT14.3.6

AMM02414G 0.1ml
EUR 484
Description: A Monoclonal antibody against Human IGF2. The antibodies are raised in Mouse and are from clone 519CT14.3.6. This antibody is applicable in WB, E

Anti-IGF2 (aa81-93) antibody

STJ72637 100 µg
EUR 359

IGF2 Rabbit pAb

A14005-100ul 100 ul
EUR 308

IGF2 Rabbit pAb

A14005-200ul 200 ul
EUR 459

IGF2 Rabbit pAb

A14005-20ul 20 ul
EUR 183

IGF2 Rabbit pAb

A14005-50ul 50 ul
EUR 223

IGF2 Blocking Peptide

DF6810-BP 1mg
EUR 195

IGF2 Blocking Peptide

DF2516-BP 1mg
EUR 195

IGF2 Blocking Peptide

BF0039-BP 1mg
EUR 195


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

IGF2 cloning plasmid

CSB-CL011088HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 543
  • Sequence: atgggaatcccaatggggaagtcgatgctggtgcttctcaccttcttggccttcgcctcgtgctgcattgctgcttaccgccccagtgagaccctgtgcggcggggagctggtggacaccctccagttcgtctgtggggaccgcggcttctacttcagcaggcccgcaagccgtgt
  • Show more
Description: A cloning plasmid for the IGF2 gene.

IGF2 cloning plasmid

CSB-CL011088HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 342
  • Sequence: atgaccccgggggtcgtccatgccagtccgcctcagtcgcagagggtccctcggcaagcgccctgtgagtgggccattcggaacattggacagaagcccaaagagccaaattgtcacaattgtggaacccacattggcctgagatccaaaacgcttcgaggcaccccaaattacct
  • Show more
Description: A cloning plasmid for the IGF2 gene.

IGF2 Rabbit pAb

A2086-100ul 100 ul
EUR 308

IGF2 Rabbit pAb

A2086-200ul 200 ul
EUR 459

IGF2 Rabbit pAb

A2086-20ul 20 ul
EUR 183

IGF2 Rabbit pAb

A2086-50ul 50 ul
EUR 223

anti-IGF2 (8H1)

LF-MA30762 100 ul
EUR 527
Description: Mouse Monoclonal to IGF2

pENTR223-IGF2 vector

PVT11853 2 ug
EUR 304

Insulin Like Growth Factor 2 (IGF2) Polyclonal Antibody (Bovine), APC

  • EUR 363.00
  • EUR 3527.00
  • EUR 975.00
  • EUR 465.00
  • EUR 226.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Bovine Insulin Like Growth Factor 2 (IGF2). This antibody is labeled with APC.

Insulin Like Growth Factor 2 (IGF2) Polyclonal Antibody (Bovine), Biotinylated

  • EUR 324.00
  • EUR 2644.00
  • EUR 773.00
  • EUR 399.00
  • EUR 224.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Bovine Insulin Like Growth Factor 2 (IGF2). This antibody is labeled with Biotin.

Insulin Like Growth Factor 2 (IGF2) Polyclonal Antibody (Bovine), Cy3

  • EUR 443.00
  • EUR 4661.00
  • EUR 1259.00
  • EUR 578.00
  • EUR 260.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Bovine Insulin Like Growth Factor 2 (IGF2). This antibody is labeled with Cy3.

Insulin Like Growth Factor 2 (IGF2) Polyclonal Antibody (Bovine), FITC

  • EUR 310.00
  • EUR 2841.00
  • EUR 800.00
  • EUR 392.00
  • EUR 201.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Bovine Insulin Like Growth Factor 2 (IGF2). This antibody is labeled with FITC.

Insulin Like Growth Factor 2 (IGF2) Polyclonal Antibody (Bovine), HRP

  • EUR 331.00
  • EUR 3073.00
  • EUR 862.00
  • EUR 419.00
  • EUR 213.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Bovine Insulin Like Growth Factor 2 (IGF2). This antibody is labeled with HRP.

Transfection with miR-637 mimic suppressed proliferation and migration of VSMC while promoting apoptosis, whereas transfection with miR-637 inhibitor has the opposite effect. We also validated that the insulin-like growth factor-2 (IGF-2), an important factor in the pathogenesis of atherosclerosis, function as gene targets for miR-637.MiR-637 targets the IGF-2 contributes to the inhibition of atherosclerosis and could be a potential target for this illnesses.