Impaired neuronal proteostasis is a prominent feature of many neurodegenerative diseases, highlighting the changes in the functioning of the endoplasmic reticulum (ER). We previously reported that targets the transcription factor XBP1, a key mediator of ER stress response, delay progression of the disease and reduce aggregation of the protein in a variety of models of neurodegeneration.

To identify modifiers of disease genes that may explain the neuroprotective effects XBP1 deficiency, we performed gene expression profiling of the cerebral cortex and striatum of these animals and revealed insulin-like growth factor 2 (IGF2) as a major upregulated genes. Here, we studied the impact of IGF2 signaling in protein aggregation in the model of Huntington’s disease (HD) as a proof of concept.

cell culture studies showed that treatment IGF2 reduce the burden of mutant huntingtin aggregates intracellularly and the peptide Polyglutamine. These results were validated using induced pluripotent stem cells (IPSC) -derived medium spiny neurons of HD patients and cases of degenerative neurological diseases. Decreased levels of the mutant huntingtin protein is associated with a decrease in intracellular half-life. Decreased levels of the abnormal protein aggregation induced by IGF2 independent of autophagy activity and proteasome pathway, two major route clearance for mutant huntingtin.

Instead, IGF2 signaling increases the secretion of soluble mutant huntingtin species via exosomes and microvesicles involve changes in actin dynamics. Administration of IGF2 in HD mouse brain using gene therapy led to a significant reduction in the level of mutant huntingtin in three different animal models. In addition, analysis of postmortem brain tissue and human blood samples from HD patients showed decreased levels of IGF2. This study identifies factors that are relevant IGF2 as deregulation in HD, operates as a disease modifier that buffer accumulation of abnormal protein species.

A case of insulin-like growth factor 2-producing gastrointestinal stromal tumor with severe hypoglycemia.
Insulinlike growth factor 2 (IGF2) protects against Huntington’s disease through the extracellular disposal of protein aggregates

Effect of prenatal bisphenol A exposure on a body mass index of early childhood through the influence of epigenetics on insulin – like growth factor < em> 2 receptor (IGF two R) gene Objective: epigenetic mechanisms have been proposed to play a role in the link between exposure to the womb to bisphenol A (BPA) and childhood obesity; However, there is little evidence of this mechanism in humans.

We obtained data on obesity-associated CpG sites of epigenome-wide association study beforehand, and then examined whether methylation at CpG sites affected by prenatal exposure to BPA. We then evaluated the relationship between CpG methylation status and body mass index (BMI) in a prospective cohort of children at ages 2, 4, 6 and 8 years old.


Methods: The methylation profile of 59 children analyzed longitudinally at the age of 2 and 6 years using human Infinium Methylation BeadChip. A total of 594 CpG sites known to BMI or obesity-related sites were tested for association with prenatal BPA levels, are categorized into low and high exposure group based on the 80 percentile of maternal BPA levels (2.68 mg / g creatinine), followed by an analysis of the relationship between DNA methylation and BMI from ages 2-8.


Results: There was a significant increase in the level of methylation cg19196862 (IGF2R) at high BPA group at the age of 2 years (p = 0.00030, false discovery rate corrected p <0.10) but not at age 6. By one standard deviation increase in methylation The cg19196862 (IGF2R) at the age of 2 years, a linear mixed model analysis revealed that BMI for age 2-8 years significantly increased 0.49 (95% confidence interval; 0.08, 0.90) in girls, but not in boys.

IGF2BP2 Antibody

31088-50ul 50ul
EUR 187

IGF2BP2 antibody

70R-17908 50 ul
EUR 435
Description: Rabbit polyclonal IGF2BP2 antibody

IGF2BP2 antibody

10R-4444 100 ul
EUR 691
Description: Mouse monoclonal IGF2BP2 antibody

IGF2BP2 antibody

10R-4445 100 ul
EUR 691
Description: Mouse monoclonal IGF2BP2 antibody

IGF2BP2 antibody

10R-4448 100 ul
EUR 691
Description: Mouse monoclonal IGF2BP2 antibody

IGF2BP2 antibody

10R-4450 100 ul
EUR 691
Description: Mouse monoclonal IGF2BP2 antibody

IGF2BP2 antibody

10R-4452 100 ul
EUR 691
Description: Mouse monoclonal IGF2BP2 antibody

IGF2BP2 antibody

10R-4453 100 ul
EUR 691
Description: Mouse monoclonal IGF2BP2 antibody

IGF2BP2 Antibody

1-CSB-PA908724
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against IGF2BP2. Recognizes IGF2BP2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:5000, WB:1:200-1:1000, IHC:1:20-1:100

IGF2BP2 Antibody

DF4710 200ul
EUR 304
Description: IGF2BP2 Antibody detects endogenous levels of total IGF2BP2.

IGF2BP2 Antibody

1-CSB-PA215752
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against IGF2BP2. Recognizes IGF2BP2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:5000, WB:1:200-1:1000

IGF2BP2 Antibody

1-CSB-PA006676
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against IGF2BP2. Recognizes IGF2BP2 from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

IGF2BP2 antibody

70R-4909 50 ug
EUR 467
Description: Rabbit polyclonal IGF2BP2 antibody raised against the middle region of IGF2BP2

IGF2BP2 Antibody

1-CSB-PA011091GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against IGF2BP2. Recognizes IGF2BP2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

IGF2BP2 Antibody

ABD4710 100 ug
EUR 438

Polyclonal IGF2BP2 Antibody (C-term)

APR07955G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human IGF2BP2 (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal IGF2BP2 Antibody (C-term)

APR07956G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human IGF2BP2 (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal Goat Anti-IGF2BP2 Antibody

AMM05020G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-IGF2BP2 . This antibody is tested and proven to work in the following applications:

IGF2BP2 Conjugated Antibody

C31088 100ul
EUR 397

anti- IGF2BP2 antibody

FNab04172 100µg
EUR 505.25
  • Recommended dilution: WB: 1:200 - 1:2000
  • IHC: 1:50 - 1:100
  • Immunogen: insulin-like growth factor 2 mRNA binding protein 2
  • Uniprot ID: Q9Y6M1
  • Gene ID: 10644
  • Research Area: Epigenetics
Description: Antibody raised against IGF2BP2

Anti-IGF2BP2 antibody

PAab04172 100 ug
EUR 355

Anti-IGF2BP2 antibody

STJ24141 100 µl
EUR 277
Description: This gene encodes a member of the IGF-II mRNA-binding protein (IMP) family. The protein encoded by this gene contains four KH domains and two RRM domains. It functions by binding to the 5' UTR of the insulin-like growth factor 2 (IGF2) mRNA and regulating IGF2 translation. Alternative promoter usage and alternate splicing result in multiple variants encoding different isoforms.

Anti-IGF2BP2 antibody

STJ116038 100 µl
EUR 277
Description: This gene encodes a member of the IGF-II mRNA-binding protein (IMP) family. The protein encoded by this gene contains four KH domains and two RRM domains. It functions by binding to the 5' UTR of the insulin-like growth factor 2 (IGF2) mRNA and regulating IGF2 translation. Alternative promoter usage and alternate splicing result in multiple variants encoding different isoforms.

Anti-IGF2BP2 antibody

STJ116159 100 µl
EUR 277
Description: This gene encodes a member of the IGF-II mRNA-binding protein (IMP) family. The protein encoded by this gene contains four KH domains and two RRM domains. It functions by binding to the 5' UTR of the insulin-like growth factor 2 (IGF2) mRNA and regulating IGF2 translation. Alternative promoter usage and alternate splicing result in multiple variants encoding different isoforms.

Anti-IGF2BP2 antibody

STJ71433 100 µg
EUR 359

IGF2BP2 siRNA

20-abx920297
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

IGF2BP2 siRNA

20-abx920298
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-IGF2BP2

YF-PA17130 50 ug
EUR 363
Description: Mouse polyclonal to IGF2BP2

anti-IGF2BP2

YF-PA17131 100 ul
EUR 403
Description: Rabbit polyclonal to IGF2BP2

anti-IGF2BP2

YF-PA17132 100 ug
EUR 403
Description: Rabbit polyclonal to IGF2BP2

anti-IGF2BP2

YF-PA25633 50 ul
EUR 334
Description: Mouse polyclonal to IGF2BP2

IGF2BP2 Rabbit pAb

A14103-100ul 100 ul
EUR 308

IGF2BP2 Rabbit pAb

A14103-200ul 200 ul
EUR 459

IGF2BP2 Rabbit pAb

A14103-20ul 20 ul
EUR 183

IGF2BP2 Rabbit pAb

A14103-50ul 50 ul
EUR 223

IGF2BP2 Blocking Peptide

33R-7470 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of IGF2BP2 antibody, catalog no. 70R-4909

IGF2BP2 cloning plasmid

CSB-CL897316HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1797
  • Sequence: atgaacaagctttacatcgggaacctgagccccgccgtcaccgccgacgacctccggcagctctttggggacaggaagctgcccctggcgggacaggtcctgctgaagtccggctacgccttcgtggactaccccgaccagaactgggccatccgcgccatcgagaccctctcgg
  • Show more
Description: A cloning plasmid for the IGF2BP2 gene.

IGF2BP2 Blocking Peptide

DF4710-BP 1mg
EUR 195

IGF2BP2 Rabbit pAb

A1774-100ul 100 ul
EUR 308

IGF2BP2 Rabbit pAb

A1774-200ul 200 ul
EUR 459

IGF2BP2 Rabbit pAb

A1774-20ul 20 ul
EUR 183

IGF2BP2 Rabbit pAb

A1774-50ul 50 ul
EUR 223

IGF2BP2 Rabbit pAb

A2749-100ul 100 ul
EUR 308

IGF2BP2 Rabbit pAb

A2749-200ul 200 ul
EUR 459

IGF2BP2 Rabbit pAb

A2749-20ul 20 ul
EUR 183

IGF2BP2 Rabbit pAb

A2749-50ul 50 ul
EUR 223

Anti-IGF2BP2 (4C6)

YF-MA17417 100 ug
EUR 363
Description: Mouse monoclonal to IGF2BP2

Mouse Igf2bp2 ELISA KIT

ELI-21434m 96 Tests
EUR 865

IGF2BP2 ELISA KIT|Human

EF010312 96 Tests
EUR 689

Human IGF2BP2 shRNA Plasmid

20-abx957254
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse IGF2BP2 shRNA Plasmid

20-abx983314
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human IGF2BP2 ELISA KIT

ELI-48205h 96 Tests
EUR 824

IGF2BP2 ORF Vector (Human) (pORF)

ORF005232 1.0 ug DNA
EUR 95

Igf2bp2 ORF Vector (Mouse) (pORF)

ORF047733 1.0 ug DNA
EUR 506

pECMV-Igf2bp2-m-FLAG-1

PVT17674 2 ug
EUR 258

pECMV-Igf2bp2-m-FLAG-2

PVT17865 2 ug
EUR 258

IGF2BP2 ELISA Kit (Human) (OKCA01313)

OKCA01313 96 Wells
EUR 846
Description: Description of target: RNA-binding factor that recruits target transcripts to cytoplasmic protein-RNA complexes (mRNPs). This transcript 'caging' into mRNPs allows mRNA transport and transient storage. It also modulates the rate and location at which target transcripts encounter the translational apparatus and shields them from endonuclease attacks or microRNA-mediated degradation. Binds to the 5'-UTR of the insulin-like growth factor 2 (IGF2) mRNAs. Binding is isoform-specific. Binds to beta-actin/ACTB and MYC transcripts.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 31.25 pg/mL

Igf2bp2 sgRNA CRISPR Lentivector set (Mouse)

K5005401 3 x 1.0 ug
EUR 339

IGF2BP2 sgRNA CRISPR Lentivector set (Human)

K1024901 3 x 1.0 ug
EUR 339

Insulin Like Growth Factor 2 mRNA Binding Protein 2 (IGF2BP2) Polyclonal Antibody (Human)

4-PAL616Hu01
  • EUR 261.00
  • EUR 2734.00
  • EUR 676.00
  • EUR 330.00
  • EUR 220.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IGF2BP2 (Ser141~Pro384)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Insulin Like Growth Factor 2 mRNA Binding Protein 2 (IGF2BP2)

Insulin Like Growth Factor 2 mRNA Binding Protein 2 (IGF2BP2) Polyclonal Antibody (Mouse)

4-PAL616Mu01
  • EUR 266.00
  • EUR 2813.00
  • EUR 694.00
  • EUR 337.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IGF2BP2 (Ile293~His557)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Insulin Like Growth Factor 2 mRNA Binding Protein 2 (IGF2BP2)

Insulin Like Growth Factor 2 mRNA Binding Protein 2 (IGF2BP2) Polyclonal Antibody (Human), APC

4-PAL616Hu01-APC
  • EUR 367.00
  • EUR 3581.00
  • EUR 989.00
  • EUR 470.00
  • EUR 228.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IGF2BP2 (Ser141~Pro384)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Insulin Like Growth Factor 2 mRNA Binding Protein 2 (IGF2BP2). This antibody is labeled with APC.

Insulin Like Growth Factor 2 mRNA Binding Protein 2 (IGF2BP2) Polyclonal Antibody (Human), Biotinylated

4-PAL616Hu01-Biotin
  • EUR 327.00
  • EUR 2684.00
  • EUR 783.00
  • EUR 403.00
  • EUR 225.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IGF2BP2 (Ser141~Pro384)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Insulin Like Growth Factor 2 mRNA Binding Protein 2 (IGF2BP2). This antibody is labeled with Biotin.

Insulin Like Growth Factor 2 mRNA Binding Protein 2 (IGF2BP2) Polyclonal Antibody (Human), Cy3

4-PAL616Hu01-Cy3
  • EUR 447.00
  • EUR 4733.00
  • EUR 1277.00
  • EUR 585.00
  • EUR 263.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IGF2BP2 (Ser141~Pro384)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Insulin Like Growth Factor 2 mRNA Binding Protein 2 (IGF2BP2). This antibody is labeled with Cy3.

Insulin Like Growth Factor 2 mRNA Binding Protein 2 (IGF2BP2) Polyclonal Antibody (Human), FITC

4-PAL616Hu01-FITC
  • EUR 313.00
  • EUR 2884.00
  • EUR 811.00
  • EUR 396.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IGF2BP2 (Ser141~Pro384)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Insulin Like Growth Factor 2 mRNA Binding Protein 2 (IGF2BP2). This antibody is labeled with FITC.

Insulin Like Growth Factor 2 mRNA Binding Protein 2 (IGF2BP2) Polyclonal Antibody (Human), HRP

4-PAL616Hu01-HRP
  • EUR 334.00
  • EUR 3120.00
  • EUR 873.00
  • EUR 424.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IGF2BP2 (Ser141~Pro384)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Insulin Like Growth Factor 2 mRNA Binding Protein 2 (IGF2BP2). This antibody is labeled with HRP.

Insulin Like Growth Factor 2 mRNA Binding Protein 2 (IGF2BP2) Polyclonal Antibody (Human), PE

4-PAL616Hu01-PE
  • EUR 313.00
  • EUR 2884.00
  • EUR 811.00
  • EUR 396.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IGF2BP2 (Ser141~Pro384)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Insulin Like Growth Factor 2 mRNA Binding Protein 2 (IGF2BP2). This antibody is labeled with PE.

Insulin Like Growth Factor 2 mRNA Binding Protein 2 (IGF2BP2) Polyclonal Antibody (Mouse), APC

4-PAL616Mu01-APC
  • EUR 374.00
  • EUR 3689.00
  • EUR 1016.00
  • EUR 481.00
  • EUR 232.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IGF2BP2 (Ile293~His557)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Insulin Like Growth Factor 2 mRNA Binding Protein 2 (IGF2BP2). This antibody is labeled with APC.

Insulin Like Growth Factor 2 mRNA Binding Protein 2 (IGF2BP2) Polyclonal Antibody (Mouse), Biotinylated

4-PAL616Mu01-Biotin
  • EUR 332.00
  • EUR 2763.00
  • EUR 803.00
  • EUR 411.00
  • EUR 228.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IGF2BP2 (Ile293~His557)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Insulin Like Growth Factor 2 mRNA Binding Protein 2 (IGF2BP2). This antibody is labeled with Biotin.

Insulin Like Growth Factor 2 mRNA Binding Protein 2 (IGF2BP2) Polyclonal Antibody (Mouse), Cy3

4-PAL616Mu01-Cy3
  • EUR 457.00
  • EUR 4877.00
  • EUR 1313.00
  • EUR 600.00
  • EUR 267.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IGF2BP2 (Ile293~His557)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Insulin Like Growth Factor 2 mRNA Binding Protein 2 (IGF2BP2). This antibody is labeled with Cy3.

Insulin Like Growth Factor 2 mRNA Binding Protein 2 (IGF2BP2) Polyclonal Antibody (Mouse), FITC

4-PAL616Mu01-FITC
  • EUR 319.00
  • EUR 2971.00
  • EUR 832.00
  • EUR 405.00
  • EUR 205.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IGF2BP2 (Ile293~His557)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Insulin Like Growth Factor 2 mRNA Binding Protein 2 (IGF2BP2). This antibody is labeled with FITC.

Insulin Like Growth Factor 2 mRNA Binding Protein 2 (IGF2BP2) Polyclonal Antibody (Mouse), HRP

4-PAL616Mu01-HRP
  • EUR 341.00
  • EUR 3213.00
  • EUR 897.00
  • EUR 433.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IGF2BP2 (Ile293~His557)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Insulin Like Growth Factor 2 mRNA Binding Protein 2 (IGF2BP2). This antibody is labeled with HRP.

Insulin Like Growth Factor 2 mRNA Binding Protein 2 (IGF2BP2) Polyclonal Antibody (Mouse), PE

4-PAL616Mu01-PE
  • EUR 319.00
  • EUR 2971.00
  • EUR 832.00
  • EUR 405.00
  • EUR 205.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IGF2BP2 (Ile293~His557)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Insulin Like Growth Factor 2 mRNA Binding Protein 2 (IGF2BP2). This antibody is labeled with PE.

Igf2bp2 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K5005402 1.0 ug DNA
EUR 154

Igf2bp2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K5005403 1.0 ug DNA
EUR 154

Igf2bp2 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K5005404 1.0 ug DNA
EUR 154

IGF2BP2 sgRNA CRISPR Lentivector (Human) (Target 1)

K1024902 1.0 ug DNA
EUR 154

IGF2BP2 sgRNA CRISPR Lentivector (Human) (Target 2)

K1024903 1.0 ug DNA
EUR 154

IGF2BP2 sgRNA CRISPR Lentivector (Human) (Target 3)

K1024904 1.0 ug DNA
EUR 154

IGF2BP2 Protein Vector (Human) (pPB-C-His)

PV020925 500 ng
EUR 329

IGF2BP2 Protein Vector (Human) (pPB-N-His)

PV020926 500 ng
EUR 329

IGF2BP2 Protein Vector (Human) (pPM-C-HA)

PV020927 500 ng
EUR 329

IGF2BP2 Protein Vector (Human) (pPM-C-His)

PV020928 500 ng
EUR 329

IGF2BP2 Protein Vector (Mouse) (pPB-C-His)

PV190930 500 ng
EUR 603

IGF2BP2 Protein Vector (Mouse) (pPB-N-His)

PV190931 500 ng
EUR 603

IGF2BP2 Protein Vector (Mouse) (pPM-C-HA)

PV190932 500 ng
EUR 603

IGF2BP2 Protein Vector (Mouse) (pPM-C-His)

PV190933 500 ng
EUR 603

Igf2bp2 3'UTR Luciferase Stable Cell Line

TU109961 1.0 ml Ask for price

Igf2bp2 3'UTR GFP Stable Cell Line

TU159961 1.0 ml Ask for price

Igf2bp2 3'UTR Luciferase Stable Cell Line

TU206151 1.0 ml Ask for price

Igf2bp2 3'UTR GFP Stable Cell Line

TU256151 1.0 ml Ask for price

IGF2BP2 3'UTR GFP Stable Cell Line

TU060526 1.0 ml
EUR 1521

IGF2BP2 3'UTR Luciferase Stable Cell Line

TU010526 1.0 ml
EUR 1521

Insulin Like Growth Factor 2 mRNA Binding Protein 2 (IGF2BP2) Polyclonal Antibody (Human), APC-Cy7

4-PAL616Hu01-APC-Cy7
  • EUR 614.00
  • EUR 7042.00
  • EUR 1858.00
  • EUR 821.00
  • EUR 337.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IGF2BP2 (Ser141~Pro384)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Insulin Like Growth Factor 2 mRNA Binding Protein 2 (IGF2BP2). This antibody is labeled with APC-Cy7.

Insulin Like Growth Factor 2 mRNA Binding Protein 2 (IGF2BP2) Polyclonal Antibody (Mouse), APC-Cy7

4-PAL616Mu01-APC-Cy7
  • EUR 628.00
  • EUR 7258.00
  • EUR 1912.00
  • EUR 842.00
  • EUR 344.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IGF2BP2 (Ile293~His557)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Insulin Like Growth Factor 2 mRNA Binding Protein 2 (IGF2BP2). This antibody is labeled with APC-Cy7.

Insulin Like Growth Factor 2 mRNA Binding Protein 2 (IGF2BP2) Antibody

abx025600-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Insulin Like Growth Factor 2 mRNA Binding Protein 2 (IGF2BP2) Antibody

abx025600-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Insulin Like Growth Factor 2 mRNA Binding Protein 2 (IGF2BP2) Antibody

20-abx015090
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Insulin Like Growth Factor 2 mRNA Binding Protein 2 (IGF2BP2) Antibody

20-abx212276
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

The indirect effect of prenatal BPA exposure during early childhood through methylation cg19196862 BMI (IGF2R) at the age of 2 years of marginal significance.